A Research on Arginine-Rich Peptides Conjugated Oligonucleotide Targeting to Telomerase

Posted on
  • Tuesday, 22 November 2011
  • by
  • andri fredi
  • in
  • Labels:
  • A Research on Arginine-Rich Peptides Conjugated Oligonucleotide Targeting to Telomerase

     Yuefeng Peng , Changpo Chen , Lihe Zhang 

    National Research Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences and School of Chemistry & molecule engineering


    Abstract:    Antisense oligonucleotide is a kind of important molecular biological research tool and potent therapeutics. However, many classes of oligonucletides are polyanions and can not pass through cell membrane. It was reported that arginine-rich peptide such HIV Tat derived peptide has transmembrane function.  Telomerase is a new target of anticancer therapy. An on-resin fragment coupling method for the peptide oligonucleotide conjugation is developed  and is applied to the assembly of arginine-rich peptide oligonucleotide conjugate. This method avoids the precipitation occurred in the solution phase fragement coupling of basic peptide and oligonucleotide. R9C,R6C and TAT conjugated ODNs targeting to telomerase are synthesized with the on-resin method. The transmembrane activity of R9C conjugated oligonucleotide was investigated using confocal fluorescence microscopy.

    key words: peptide, oligonucleotide, peptide-conjugated antisense oligonucleotide, telomerase

    INTRODUCTION
        With the achievement of HGP(human genome project) and the development of functional genomics, antisense drugs and antisense technology find their way in the new drug research and molecular biological science. For the therapeutic application, the problem of the permeability to the cell membrane and its instability in cells limit the biological activity of the antisense oligonucleotide. Scientists have tried to find some ways to increase oligonucleotide’s ability of penetrating cell and nucleous membrane. Recently it was demonstrated that the conjugate of transduction peptide with oligonucleotide can both increase the stability and the antisense activity of the oligonucleotide dramatically. The most attractive peptide sequence is the basic fragment of HIV Tat protein which has a arginine-rich sequence.[1] It was reported that Tat protein can penetrate both the outer membrane of cells and the membrane of nucleus. A comparative research of Tat derived peptide and polyarginine demonstrates that arginine residues play an important role in TAT protein penetrating cell membrane. [2]
    Telomerase is a new target of cancer therapy. Relative studies demonstrate that over 80 percent primary cancer cells have the higher telomerase activities comparing to the normal cells. The higher activities of telomerase may relate to the maintenance of the reproductive ability of the cancer cells. Hence the inhibitors of telomerase play an important part in the research of the biological function of telomere and telomerase. Telomerase inhibitor may be developed into a new kind of anticancer agents. Telomerase consists of RNA template and enzyme protein, so the antisense oligonucleotide targeting to its RNA template can effectively inhibit the activity of telomerase in vitro. Some antisense sequences targeting to telomerase’s mRNA were suggested by Sheng-qi Wang. TRAP-PCR analysis and the result of Weston-blot showed that one of the sequences dramatically inhibits the activity of telomerase at micromole concentration.

    RESULT AND DISCUSSION
    1.  The peptide and oligonucletide sequences
       The antisense sequence targeting to mRNA of the telomerse protein is ACTCACTCAGGCCTCAGACT, and the antisense sequence targeting to the RNA template is CTCAGTTAGGGTTAGACAA.
        Considering the excellent transmembrane activity, we designed the argnine-rich peptide sequence and investigated the synthetic conditions for the coupling reaction between the argnine-rich peptide and ODN. The designed peptide sequences are as follows:
    ArgArgArgArgArgArgCys, (R6C)
                             ArgArgArgArgArgArgArgArgArgCys, (R9C)                        
    D-ArgD-ArgD-ArgD-ArgD-ArgD-ArgD-ArgD-ArgCys, (D-R9C)
    ArgLysLysArgArgGlnArgArgArgCys(Tat peptide), (TAT)

    2. The synthetic strategy
    As mentioned above, although scientists have undergone so many meaningful exploration of the synthesis of the antisense oligonucleotide, there is not a general method for the synthesis of peptide-oligonucleotide conjugate. There are several methods for the synthesis of the argnine-rich peptide- oligonucleotide conjugates [4,7-9]. Generally, -SH group is used in the peptide sequence and linked with the ODN activated by maleimido or haloacetyl functions, or the –SH reacts with the oligonucleotide containing –SH to form the conjugate linked by -S-S-. Robles used Fmoc to protect the guanidine group of arginine and applied to synthesize the arginine-rich peptide-oligonucletide conjugate by in-line synthesis. However, when we used a double-Fmoc-protected arginine for the synthesis of the designed conjugate, we only got a complicated product. Hence, we chose to use disulfide to link the ODN and the peptide. This strategy can avoid the incompatibility of peptide chemistry and oligonucleotide chemistry in the conjugate synthesis, on the other hand, the disulfide linkage can be reduced after entering the cells and release the antisense



    3. oligonucleotide synthesis
     The method for the synthesis of oligonucleotide was standard phosphoramidite chemistry and the block containing –S-S- functional group was coupled during the last step of the synthesis. After the –S-S- of ODN (I) was reduced with DTT, the mixture was purified by HPLC, and the oligonucleotide containing free –SH reacted with dithiodipyridine to form oligonucleotide (II) with the terminal sulfhlydral group. In order to investigate the penetrating activity of the designed conjugate, we also synthesized the  3’-FITC-5’-S-S-ODN (III). The 3’-amino compound (II) could react with fluorescence isothiocyanate(FITC) to produce 3’-FITC-5’-S-S-ODN (III). The resultant product was conjugated with the peptide to produce the fluorescence-labeled conjugate (IV). (Fig.2, Fig.3) 

    For more information u can download here




    0 comments:

    Post a Comment