Antisense-oligonucleotides targeting tumor necrosis factor-alpha in murine herpes simplex virus type 1 retinitis

1. INTRODUCTION

1.1 Acute retinal necrosis (ARN)

ARN syndrome is a well-known clinical entity that was first described in 1971 (Urayama et al., 1971). ARN is a type of retinitis that affects both healthy and immunocompromised patients (Silverstein et al., 1997; Batisse et al., 1996; Nussenblatt et al., 1989). Patients typically experience blurred vision, eye pain, and light sensitivity, in one or sometimes both eyes. Several members of the herpes virus family including herpes simplex virus (HSV)-1, HSV-2, varicella zoster virus (VZV) and, rarely, cytomegalovirus (CMV) are the main causing viruses (Silverstein et al., 1997; Atherton et al., 2001; Lewis et al., 1989; Thompson et al., 1994; Hellinger et al., 1993; Ganatra et al., 2000).

1.1.1 Virology of herpes viruses
They all have a large number of enzymes available that are involved in nucleic acid metabolism, DNA synthesis, and possibly the procession of proteins. The synthesis of DNA and the assembly of the capsid take place in the nucleus. The production of infectious virus particles may lead to the destruction of the infected cell. Furthermore, the herpes viruses establish latent infection in their natural hosts (Roizman et al., 1996). During latency, the herpes virus genomes form closed circular molecules, and only a small number of viral proteins are expressed. There is evidence that selected regulatory genes are active and may maintain latency, but neither the mechanisms to keep the status of latency nor the factors that cause reactivation of viral replication are yet completely known. After reactivation, infectious viruses are transported to peripheral tissues, e.g., by axonal transport in HSV infection (or retrograde transport back to the locus of primary infection). The immune response of the host may determine whether reactivation may result in a symptomatic or asymptomatic course of herpetic disease (Roizman et al., 1996; Roizman & Sears , 1996)

1.1.2 Pathogenesis of HSV-1 induced experimental acute retinal necrosis
The acute stage of ARN is characterized by necrotizing retinitis of all retinal layers. The retinal vessels in the diseased area show fibrinoid necrosis of the vessel wall and vascular occlusion. The retinal pigment epithelium (RPE) shows focal necrosis and is occasionally separated from Bruch’s membrane. The necrotizing retinal cells may reach the overlying vitreous body, where inflammatory cells group around it. The necrotizing retina is mostly sharply demarcated adjacent to the intact retina. In the marginal areas, intranuclear inclusions can be noted histologically, and by electron microscopy, virus particles can be detected in the retinal cells (Minckler et al., 1976; Cibis et al.,1978; Johnson et al.,1977). The adjacent choroid shows severe choroiditis with vascular occlusions. At the same time, optic nerve neuritis and papillitis arises. Inflammatory cells are infiltrating the aqueous humor and the anterior chamber angle. The iris and ciliary body show non-granulomatous and granulomatous cell infiltration and perivasculitis (Culbertson et al., 1982; Naumann et al., 1968; Culbertson et al.,  1986). In the healing phase, the process leads to complete disintegration of the retina and the optic nerve, with reactive metaplasia of the retinal pigment epithelium (Cogan et al., 1964; Rummelt et al., 1992).
Herpes viruses were demonstrated in the retinal lesions and vitreous body in ARN patients by culture methods, histology, electron microscopy, immunohistochemistry, and by polymerase chain-reaction methods (Lewis et al., 1989; Culbertson et al., 1982; Pavan-Langston & Dunkel, 1989; Forster et al., 1990; Culbertson et al., 1986; Pepose & Whittum-Hudson, 1987). After primary infection or reactivation from latency, herpes virus replication follows. From animal experiments (Forster et al., 1990) it is known that viruses migrate through the ipsilateral parasympathetic fibers of the oculomotor nerve that serve the iris and ciliary bodies in the central nervous system. The viral replication within the CNS is fairly well limited to the nucleus of the visual system and to the suprachiasmatic area of the hypothalamus. Viruses than migrate from the brain to the retina via retrograde axonal transport through the optic nerve, along the endocrine-optic path between the retina and the suprachiasmatic nucleus of the hypothalamus.
At this site, the viral invasion can spread out to the contralateral regions, which may explain the involvement of the fellow eye in patients with bilateral acute retinal necrosis (BARN). Along the optic nerve, the viruses may also reach the ganglionic cells of the contralateral retina (Pettit et al., 1965).
The retinal pathology represents a viral-induced cytopathology (Holland et al., 1987; Whittum-Hudson & Pepose, 1987). However, the accompanying immune reactions are decisive for the further inflammatory process that finally results in the development of retinal necrosis (Holland et al., 1987.; Whittum et al., 1984). Local as well as systemic factors come into effect here (Whittum et al., 1984). It has been shown that the retinal HSV infection is under the control of T lymphocytes in experimental herpetic retinitis (Whittum-Hudson et al., 1985). A contribution of T lymphocytes in the pathogenesis of human ARN has been suggested (Verjans et al., 1998).
The severe vascular occlusions lead to ischemia of the retina and choroid and further promote the development of necrosis. The massive breakdown of the blood-retina barrier with the resulting increase of the protein content in the vitreous is associated with a proliferative effect on the pigment epithelium and the fibroblasts.  This may further support the development of proliferative vitreoretinopathy (PVR). The necrotic-related retinal tears and the developing traction from the vitreous space then finally result in the emergence of retinal detachment.

1.2 von Szily model

von Szily was the first scientist who reported about acute retinal necrosis syndrome in rabbits in 1924 (Von Szily, 1924). After injecting replication herpes simplex virus into the right anterior chamber of a rabbit, a rapidly destructive retinitis of the opposite (left) eye developed. The histopathologic analysis of the inoculated eye, however, disclosed that the retina of the injected (right) eye was more or less completely spared of this destructive phenomenon. 
It has been shown that inoculation of the KOS strain of HSV-1 into the anterior chamber of one eye of BALB/c mice induced characteristic retinal changes, including a devastating inflammatory reaction within the posterior segment of the uninoculated eye, resulting in pan-necrosis of the retina 10 to 14 days post inoculation (PI) (Whittum et al., 1984).
Diverse inbred strains of mice have been shown to vary considerably in their resistance and susceptibility to that HSV induced retinal necrosis syndrome. The different strains of BALB/c, C57BL/6 and F1 hybrid had been studied to define the resistance and susceptibility to HSV retinitis. Injected eyes of BALB/c mice showed an anterior uveitis with HSV-1 antigens in the anterior segment and an intact retina that was free of HSV antigens. The retina of the contralateral uninjected eye, in contrast, was necrotic and contained HSV-1 antigens. In both, C57BL/6 and F1 mice, HSV antigens were limited to the structures of the anterior segment in the injected eye, whereas, in contrast to BALB/c mice, the contralateral retina appeared histologically normal and contained no viral antigens. Furthermore, these strains also remained relatively resistant to retinal infection despite being immunosuppressed by radiation (Pepose et al., 1987; Whittum & Pepose, 1988). Another study showed that DBA/2 mice were mildly resistant to HSV-1 retinitis in the uninoculated eye (Kielty et al., 1987).
Although HSV inoculated into anterior chamber of mouse in general induced retinitis, the different strains of HSV induced different courses of that disease. Whereas HSV-1 produces a rapid, explosive retinitis that led to destruction of all cell layers of contralateral retina, HSV-2 induced a retinitis in the ipsilateral eye that was more gradual in onset (Dix et al., 1987).
Inoculation of HSV-1 (KOS) into the anterior chamber of BALB/c mouse eyes produces an intense inflammatory reaction at the inoculation site. Intensity and speed of the inflammatory reaction are dose-dependent over a wide range: 2×102 to 2×105 plaque forming units (PFU) HSV-1. The dose of 2×104 PFU was chosen by the researchers for the following reasons: (1) this particular dose of virus induced anterior chamber-associated immune deviation (ACAID), i.e., recipient mice produced high titers of circulating anti-HSV-1 antibody, but failed to develop T-cell immunity as measured by the capacity to express HSV-1 specific delayed type hypersensitivity (DTH); (2) when inoculated subcutaneously, this dose of virus regularly induced vigorous DTH to HSV-1 as well as humoral anti-HSV-1 responses; and (3) lid vesicles were observed uncommonly after AC inoculation of 2×104PFU HSV, whereas at higher doses lid lesions regularly occurred, raising the possibility that auto-inoculation of virus by infected mice would unduly confound the analysis. Within this dose range, the only visible manifestation of disease in AC-inoculated mice was in the injected eye. None of the mice died or developed signs of disease at other sites (Whittum et al., 1983; Whittum et al.,1984).
In the HSV-1 inoculated eyes, the inflammatory reaction commonly involves the entire anterior segment. The cornea rapidly becomes edematous, and an inflammatory cell infiltration and neovascularization occurs. The central stromal infiltrate peaks by day 7 and resolved completely by day 21. The extensive neovascularization reaches its maximum intensity by day 14. The extensive loss of corneal clarity observed by slit lamp corresponds with the edema and disruption of the stromal architecture. By day 5, the corneal endothelium is destroyed. The anterior chamber of injected eyes contains an increasingly severe cell and flare reaction that is already visible by 1 day after virus inoculation. Over 21 days, the anterior chamber becomes progressively more shallow (loss of form or depth), and it is occupied by a fibrovascular tissue development between day 14 and 21 PI. Iris infiltration and loss of iris integrity are both evident at day 1. Iris atrophy (loss of iris stroma and vessels) occurs by day 3 (Whittum et al., 1984).
In contralateral eye, the inflammatory reaction involves mainly the posterior segment.  The infectious process in the retina of the uninoculated eye has been divided in three phases: acute retinitis, retinal necrosis, and resolution (Cousins et al., 1989). Acute retinitis is observed between days 7 and 9 PI. The retina remains normal until day 7 PI. At this time, small foci of inflammatory cells appear around one or two small vessels in the ganglion cell layer (GCL). These foci are limited generally to one lateral aspect of the GCL per eye, midway between the optic nerve and the anterior edge of the retina (ora serrata). The remainder of the GCL appears normal at this time, as do the outer layers of the retina and underlying choroid.
The retinal necrosis begins on day 10 PI. By day 10, a large necrotic area containing a mixed inflammatory infiltrate extends posteriorly through the entire retina. The choroid underlying the necrotic area also is infiltrated. Inflammatory cells can occasionally be seen around the optic nerve at this time. By day 14 PI, the retina is completely necrotic with inflammatory cells, debris and numerous plasma cells interspersed throughout the disrupted retinal cells. In addition, the choroid is infiltrated extensively.
The resolution phase usually begins on or about day 15 PI. The remnants of the retina are organized into a fibrocellular scar, and the ocular inflammation is gradually resolved (Azumi et al., 1994; Zaltas et al., 1992; Azumi & Atherton, 1998; Cousins et al., 1989).
Following anterior chamber inoculation of HSV-1 into one eye of BALB/c mice, a certain pattern of ocular pathology as well as systemic immune response emerges. It is a suppression of DTH responses to the injected HSV with an intact HSV-1 neutralizing antibody response. This phenomenon is termed anterior chamber associated immune deviation (Whittum et al., 1983). However, compared with the BALB/c strain, the AC infection in C57BL/6 mice was not followed by a contralateral retinitis, while the mice showed a vigorous HSV-1 specific DTH response. Therefore, is has been suggested that the absence of contralateral retinitis might be linked to the induction of virus-specific DTH response. It has been speculated that DTH inducing T-effector cells or other mechanisms might limit the amount of virus that reaches the CNS, which in turn affects the amount of second wave of virus which reaches to uninoculated contralateral eye (Kielty et al., 1987)
The virus culture studies have revealed that virus reaches the uninoculated eye in two temporally separate waves after uniocular anterior chamber inoculation. The first wave of virus is detected in the uninoculated eye as early as one day PI, long before virus is found in either of the optic nerves or the brain. The second wave of virus arrives in the uninoculated eye between 7 and 10 days PI (Atherton & Streilein, 1987).
Kahn (1993) investigated the effect of light onto von Szily model. His findings suggested that virus does not reach the contralateral retina in dark-reared mice. He found a decrease in neuronal firing and retrograde axoplasmic flow during darkness (Kahn et al., 1993). Colchicine is known for its axonal-transport-blocking capabilities. It was used to examine whether virus is transported via the optic nerve to the uninoculated eye after anterior chamber inoculation of HSV-1. The results demonstrated that blocking the optic nerve with colchicine prevented the entry of only the second-wave of virus, while the first-wave of virus was not affected. This observation supported the hypothesis that the second-wave of virus reaches the contralateral eye from the central nervous system via the optic nerve (Bosem et al., 1990).
The route of second wave of virus spread was also studied by Vann and Atherton (Vann & Atherton, 1991) in BALB/c mice. The data showed that virus spreads from the injected eye to the central nervous system (CNS) through parasympathetic fibers of the oculomotor nerve that supply the iris and ciliary body. The virus spread in the CNS is limited primarily to the nuclei of the visual system and the suprachiasmatic area of the hypothalamus. Subsequently, the virus is transmitted from the CNS to the retina of the contralateral eye by retrograde axonal transport through the optic nerve along the endocrine-optic pathway between the retina and the suprachiasmatic nucleus (SCN) of the hypothalamus (Fig 1).

1.3 Participation of the immune response to the injected virus

Researchers have concluded that immune response participates in the course of the HSV-1-induced contralateral retinitis (Atherton et al., 1989; Whittum-Hudson et al., 1985). Using flow cytometry and immunohistochemistry, Azumi (Azumi & Atherton, 1998) documented that T cell play a role in the disease. At day 9 PI (acute retinitis), T cells were observed in the uvea but not in the retina of contralateral eye. The CD4+ and CD8+ T cells were found in the sensory retina coincident with the onset of retinal necrosis (day 11 PI), and CD4+ and CD8+ T cells were then detected in the remnants of the retina until day 63 PI. The maximum number of infiltrating cell, both of the CD4+ and CD8+ subgroups were observed at day 21 PI.
Another investigation by the same group of researchers suggested that the CD4+ T cell subset contributes to the destruction of the retina, and may accelerate the cellular infiltration and inflammation-induced retinal destruction at day 14 (retinal necrosis phase). At least 2 weeks before inoculation of virus, T-cell-depleted BALB/c mice were injected intravenously with anti-CD4 monoclonal antibody. Indeed, the treatment with an anti-CD4 monoclonal antibody in the von Szily model modified the virus recovery from the posterior segment of the contralateral eye significantly. By day 14 PI, significantly higher titers of virus were recovered from the mice that were depleted of CD4+ cells. In conclusion, the CD4+ T cells are involved in virus clearance from contralateral eye (Azumi et al., 1994).
The Mac-1 positive cells (macrophages, natural-killer cells, and polymorphonuclear neutrophils) appear in contralateral ciliary body between day 8 and 10 PI. On day 10, a large number of Mac-1 positive cells infiltrate the retina, and mainly the inner retinal layers. Simultaneously, Mac-1 positive cells also infiltrated the choroid. The finding of a predominance of Mac-1 cells in the contralateral retina of susceptible BALB/c mice on day 10 led the researchers to speculate that the cells might be important mediators of necrotizing in contralateral retinal necrosis phase (Zaltas et al., 1992). The DNA microarray results showed that macrophage-related genes were up-regulated in the contralateral eye at day 9 PI. Additional immunohistochemical studies also showed the presence of F4/80-positive cells in the retina (Zheng et al., 2003). In further experiments, an anti-CD11b mAB was injected intravitreally before the first wave of inflammatory cells arrived to the eye. This resulted in a profound suppression of retinal necrosis with significant decrease in both the incidence and the severity of the retinitis, even though herpes simplex viral particles could be detected in the chorioretinal layers of unaffected eyes by indirect immunofluorescence. In agreement with these data, a suppression of retinal necrosis was also noted when macrophages were depleted from mice by the treatment with Cl2MDP-liposomes. The timing of the anti-CD11b mAb injection appeared to be critical for the inhibition of contralateral retinitis. Suppression of retinal necrosis was effective only when the antibody was administered before the onset of clinical signs. Once the initial clinical signs of contralateral retinitis were observed, anti-CD11b mAb did not alter the course of the disease (Berra et al.,1994). These findings suggested that macrophages are important participants in the effector phase of the inflammatory immune response in HSV-1 induced contralateral retinitis. Macrophages probably play a multifunctional role in the pathogenesis of the disease by direct cytotoxic action and indirectly by releasing chemotactic and immunoregulatory cytokines that finally contribute to retinal destruction. Other possibilities are that they are acting as antigen presenting cells (APC) to increase T-cell function (accessory function of macrophages). They can also provide costimulatory signals to increase effector T-cell function by B7.1/B7.2.
Beside the inflammatory cells, various cytokines and chemokines are actively involved in the course of HSV-1 retinitis. DNA microarray was used to analyze the expression patterns of genes in the uninoculated eye following uniocular anterior chamber inoculation of HSV-1. The most abundant cytokines and chemokines in the contralateral eyes of mice with HSV-1 retinitis were the IFN-family and their receptors, the interleukins IL-1, IL-6, and IL-4 and their receptors, and macrophage inflammatory protein (MIP-1 and MIP-2) and their receptors. Since these cytokine and cytokine-receptor genes were up-regulated in the uninoculated eye at the peak of acute retinal infection, these results suggested that they are likely to be the modulators most closely related to ARN (Zheng et al., 2003). From RT-PCRs assay, the transcriptions of some cytokines were investigated. IFN-g-mRNA was moderately elevated on day 6 PI, increased slightly between days 6 and 8 PI, and then increased slightly again between day 8 and 11 PI. On day 6 and 8 PI, the level of mRNA for IL-4 was only slightly above that observed in the uninjected eyes of the mock-infected mice. Between day 8 and 11 PI, the amount of IL-4 mRNA increased approximately three fold. IFN-γ+ and IL-4+ cells were observed throughout the retina. Most of CD4+, Gr-1+, CD19+ and F4/80+ cells expressed IFN-γ and IL-4 (Zheng et al., 2005).

1.4 Tumor necrosis factor-alpha

The proinflammatory cytokine tumor necrosis factor alpha (TNF-α) originally was identified as a serum factor causing hemorrhagic necrosis of tumors and inducing cachexia. TNF-α is now known to possess many cell-activating and pro-inflammatory activities. TNF-α is produced by many cell types, among them are macrophages, T cells, and natural killer cells. The pro-inflammatory effects include induction of expression or up-regulation of major histocompatibility complex molecules (Sartani et al., 1996; Fong & Lowry, 1990; Fleisher et al., 1990). TNF-α exerts its actions through two distinct receptors: TNF RI (P55) and TNF RII (P75). The TNF-induced cytotoxicity has been attributed in the past to the p55 receptor, and TNF-induced proliferation to the p75 receptor.  However, it has been shown, that p75 can greatly enhance p55-induced cell death (Koizumi et al., 2003; Bigda et al., 1994; Tartaglia et al., 1991 ).
The TNF/TNF-R family plays a key role in the activation, differentiation and effector responses of T-cells. Subsequent analysis of TNF-R expression revealed that antigen activation was required for the up-regulation of p75 and to a lesser extent p55 TNF-R and the acquisition of TNF responsiveness by different T-cell subsets in vitro, but more importantly at sites of inflammation (Ware et al., 1991; Brennan et al.,1992; Cope et al.,1995). Both in vitro and in vivo co-stimulatory effects may arise through different mechanisms, including activation and differentiation of antigen-presenting cells, such as dendritic cells, as well as antigen-presenting function (Sallusto et al., 1995). The treatment with rabbit anti-TNF-α serum in experimental autoimmune uveoretinitis (EAU) during the afferent stage significantly reduced the autoantigen specific lymphocyte proliferation and DTH (Sartani et al., 1996). Greiner and co-workers investigated 15 patients with posterior segment intraocular inflammation (PSII) refractory to conventional immunosuppressive therapy and who then received a single infusion of a recombinant protein generated by fusing the p55 TNF-α receptor with human IgG1. Interestingly, the authors found that the anti-TNF-α agent induced an up-regulation of IL-10-expression in peripheral blood CD4+ T cells and an alteration in the ratio of IL-10- and IFN-γ-producing CD4+ T cells (Greiner et al., 2004).
Macrophages are versatile cells that are intimately involved in diverse aspects of the immune response and inflammation. The cytotoxic macrophages and production of nitric oxide (NO) or reactive oxygen species (ROS) might cause cell membrane peroxidation and destruction. Classic macrophage activation after stimulation with IFN-γ and TNF refers to the ability of a macrophage to express nitric oxide synthase (NOS2) and generate nitrite, peroxynitrites, and superoxides, which in turn induce lipid peroxidation of cell membranes and cell death (Robertson et al., 2002; Erwing et al., 1998; Li & Verma, 2002; van Strijp et al., 1991). In experimental cutaneous leishmaniasis, the blockade of the TNF activity resulted in a reduced NOS2 expression from draining lymph nodes and macrophages (Engwerda et al., 2002; Fonseca et al., 2003). With a treatment of mice with sTNFr-IgG in the EAU model, infiltrating macrophages reduced expression nitrite production at the height of disease, and the level of apoptosis within the retina was reduced too (Robertson, 2003).
In the von Szily model, TNF-α mRNA and protein was up-regulated during the evolution of ARN (from day 6 to 14 PI) in the contralateral eyes compared with levels in control subjects (Zheng et al., 2005). The DNA microarray results showed that among the most up-regulated cytokines and chemokines in contralateral eye of mice with HSV-1 retinitis was the TNF family cytokines and their receptors (Zheng et al., 2003). The immunohistochemical stainings revealed that TNF-α was produced by infiltrating cells such as CD4+, Gr-1+, CD19+, and F/80+ cells. Approximately one third of the RPE cells produced TNF-α at day 9 PI. In addition, a smaller number (4-14%) of Müller cells also produced TNF-α at the same time (Zheng et al., 2005).
Latently infected trigeminal ganglia (strain KOS) were excised and placed in vitro. TNF-α was added daily. The reactivation replication rate in the TNF-α treated group was higher than the control group. These experiments demonstrated that TNF-α enhanced the reactivation frequency and replication of HSV (Walev et al., 1995). Also, the number of TNF-α producing cells was investigated during the acute replication phase of HSV in trigeminal ganglia. The appearance of TNF-α producing cells in the trigeminal ganglia was correlated to virulence and replication of HSV dependent on the time of appearance. The higher the virulence the earlier commenced replication and the more increased the number of TNF-α- producing cells (Walev et al., 1995).
In conclusion, it appears that TNF-α is an one of the most important pro-inflammatory cytokines in ARN (Oettinger & D’Szouza, 2003).


for more info click here
Read More...

Computational Methods for Rational Oligonucleotide PCR Primer Design and Analysis: Two Scenarios Using GCG¥’s SeqLab. By Steven M. Thomson (stevet@bio.fsu.edu)

Introduction
The Polymerase Chain Reaction, PCR, developed at Cetus Corporation by Kary Mullis in the mid ‘80’s (Saiki, et al., 1988), for which he won the Nobel Prize, and patented by Hoffman La Roche and Perkins-Elmer Corporation, has revolutionized modern molecular biology.  From Jurassic Park scenarios in popular novels, to everyday research in countless laboratories across the world, to cutting-edge forensic pathology techniques, PCR is being used to analyze tinier concentrations of DNA than ever before imagined possible.  PCR allows the investigator to analyze any stretch of DNA in any organism where at least some sequence information is known, either in that organism or in related organisms.  It can isolate, and amplify up to around a million-fold, just a few molecules of DNA from complex environmental mixtures, even where the DNA is significantly degraded — the ramifications are incredibly far-reaching.  It has been employed, among many examples, to analyze DNA in Egyptian mummies, preserved prehistoric insects in amber, ancient fossilized leaves, and both ice-age frozen and tar-pit preserved mastodons and other animals from the ‘great age of mammals.’  Claims were even made of dinosaur DNA recovery from specimens recovered in a Utah coalmine, though the results were later proven to be contamination.  The practical applications are extensive in medicine, especially in the field of prenatal genetics and, in particular with HIV, immediately postnatal diagnosis.  Other pathologies such as Lyme disease are also extremely amenable to PCR diagnosis.  Furthermore, molecular evolutionists now have a tremendous tool for inferring phylogenies of any organism, whether they can be cultured or not.  Furthermore, forensics has been completely turned about.  Now investigators can isolate the DNA from incredibly obscure bits of physical evidence, ala CSI, to positively exclude suspects based on distinct patterns, fingerprints, within their DNA. Using it to ‘prove’ guilt is more difficult because of the population genetics statistics involved, however, even these probabilities can be demonstrated within several magnitudes of order.  PCR has truly changed the face of molecular biology.
PCR is a modified primer extension reaction using a thermostable DNA polymerase that allows for the heat dissociation of newly formed complimentary DNA and subsequent hybridization of oligonucleotide probes to the target regions for subsequent rounds of amplification.  The scope and methods of PCR are huge and many varied and way beyond the aim of this workshop — I will not attempt to teach anything of the actual procedure.  Refer to any good, modern text in molecular biology for details (for some good, early reviews of PCR methodology see Mullis [1990], White et al. [1989], and Cherfas [1990]).  What I will attempt to teach is a rational method for inferring appropriate oligonucleotide probes, often known as primers, for PCR or hybridization screening analysis.  These oligonucleotides are usually about 20 or more bases in length and target the beginning and ending locations of the PCR amplification process.
Coupled with PCR techniques and/or ultra sensitive hybridization screenings, oligonucleotide primers have allowed the ‘fishing out’ of thousands of genes from complex genomes that would have previously been extremely difficult to ever even find, yet alone sequence.  Present-day economic, automated synthesis and the ready availability of nucleotides, have made primers commonplace.  (This has also facilitated the development of reliable methods for the introduction of site-specific mutations into known sequences.)  Because of the high specificity and adjustable stringency of oligonucleotide hybridization, the sequence knowledge of a relatively short stretch of unique DNA is sufficient to rapidly isolate and/or amplify, clone if desired, and sequence the corresponding gene.  However, whatever technique one may use, primers are essential ingredients.
PCR and hybridization screening both require the design of appropriate primers.  This can be a ‘hit-or-miss’ affair or you can use computational methods to greatly assist the efficiency of the process.  Several strategies can be imagined for the design of oligonucleotide primers.  If an exact nucleotide sequence is known, then a single oligonucleotide probe for hybridization or a pair of primers for PCR of a defined sequence can simply be selected, tested, and synthesized.  In the absence of a defined DNA sequence, sometimes a group of similar DNA sequences can be aligned and a consensus sequence created from which primers can be designed.  However, this is often not possible because DNA can be very, very difficult to align.  In some cases one may even be forced to work off of either a small portion of a protein sequence from an Edman degradation reaction or, as will be illustrated in this exercise, a consensus pattern from a group of related proteins — the luxury of using DNA directly is often not available.
When nucleotide data is lacking or problematic, amino acid sequences can be back translated to provide the necessary primers.  In the absence of exact protein sequence data, a consensus pattern from a group of related proteins can often be used.  Using amino acid sequence information requires one to back translate the sequence though.  This is not a trivial chore though, because of the degeneracy of the genetic code.  There are 64 possible codons for 20 amino acids.  Because of this, many different back translation probe techniques have been employed.  Two are, either utilizing large pools of short oligonucleotides whose sequences are highly degenerate, or using small pools, or even just one pair, of longer oligonucleotides of lesser or no degeneracy.  All organisms have preferential biases in codon usage and this information can be used to advantage in deciding which codons to synthesize out of all of the possible choices.  This strategy of choosing the longest defined stretches of unambiguous peptide and back translating them to their most probable oligonucleotides, is known as designing “guessmers.”
Guessmers contain the combination of codons most likely to match the authentic gene.  Guessmers work because the decrease in hybridization stability caused by mismatched bases is offset by an increase in stability from using longer sequences.  In most cases, mismatches will occur in only the third position of incorrect codon choices and, therefore, at least two of the three bases will still be matched.  Naturally, the biggest constraint on utilizing this type of strategy is that relatively long stretches of amino acid sequence are required.  Because of this, guessmers are particularly appropriate when strong and sufficiently long consensus elements can be discovered in a protein family.  They should be at least 30 nucleotides in length, in order to insure sufficient hybridization despite potential mismatches, though PCR primers are seldom designed as long as hybridization probes.  It’s also not worth the extra effort and bother to synthesize them longer than about 70 bases.  For very some early, very good descriptions of the factors involved in guessmer design and analysis and references to primary literature see Sambrook et al. (1990) and Wood (1987).
The first portion of today’s tutorial will explore guessmer design.  In order to discover possible consensus patterns within a known protein family for the design of a guessmer, the individual members must be maximally aligned and then a consensus must be created.  Alignment is usually achieved through an automated progressive, pairwise alignment procedure, here the GCG program PileUp, which inserts gaps to align the full length of its members.  Other automated alignment methods are also available such as Thompson and Higgins’ ClustalW (1994), Smith and Smith’s PIMA (1995), and Gupta et al.’s MSA (1995), as are several different manual alignment editors.  Consensus sequences can then be created from the alignment.  Many methods merely rely on the positional frequency of individual symbols; however, some utilize much more information.  Profile analysis (Gribskov et al., 1989) is one of these.  Profile analysis takes advantage of the BLOSUM (Henikoff and Henikoff, 1992) Dayhoff style scoring matrices (Schwartz and Dayhoff, 1979) that utilize the relative conservation of various amino acid substitutions within the alignment.  Therefore, the resultant consensus residues are the most evolutionarily conserved rather than just statistically the most frequent.  This can mean much more to us than an ordinary consensus and is especially appropriate in the design of the type of guessmer that we will be simulating — that is, a situation in which much sequence information for the protein of interest is known in other organisms but not in the one we are studying.
I will illustrate the design of guessmers using the prion protein as an example.  The prion molecule is responsible for a debilitating disease in animals and yet is encoded by the organism’s own DNA; the gene is expressed in both normal and afflicted cells.  Large amounts of proteinaceous plaques aggregate and are deposited in the brains of afflicted animals.  The prion protein has an unknown natural function but is found in very high quantities in the brain of animals infected with the degenerative neurological diseases scrapie and Bovine Spongiform Encephalopathy, in wild stock, and kuru, Creutzfeldt-Jacob Disease, or Gerstmann-Straussler Syndrome in humans.  It is also involved in Fatal Familial Insomnia and gained notoriety as the harbinger of “Mad-Cow Disease.”  In humans the gene maps to position 20p12-pter and the disease can be inherited in an autosomal dominant fashion.  Seventeen pathologic allelic variants are listed in OMIM (1995).  One of the most peculiar aspects of the prion is no infective nucleotide entity has ever been found, yet the protein particle itself is highly infectious.  Somehow the infectious protein particle induces a posttranslational, pathological change in the host’s normal protein to convert it to the aberrant isoform.  The primary amino acid sequence is not changed, only the structural conformation of the protein is different.  Stanley B. Prusiner of the University of California, San Francisco, won the 1997 Stockholm’s Karolinska Institute Nobel Prize in physiology or medicine because of his work on this system.  For further information, see Prusiner’s article in Science, available on the World Wide Web at: http://www.sciencemag.org/feature/data/prusiner/245.shl.
The second scenario utilizes a human papillomavirus (HPV) dataset.  HPV is known to be associated with many varieties of human genital cancers.  The DNA from certain types of HPV, in particular types 16 and 18, has been found integrated into various sites on human chromosomes, especially 12q13, and is often associated with the cis-activation of cellular oncogenes and/or the establishment of heritable fragile sites (OMIM).  HPV exists in a dizzying number of genetic types — there are almost 2000 HPV nucleotide sequences including around 50 complete HPV genomes in GenBank (Bilofsky, et al. 1986)!  Some types appear relatively benign while others have powerful etiologic roles.
The ability to easily discriminate between HPV types is obviously a valuable diagnostics tool.  PCR provides a proven methodology for achieving just this.  The HPV major capsid protein, or L1 gene as it is known, has proven to be a reliable locus for this technique.  The HPV viral coat is largely built from this protein, and, therefore, represents the first and major antigen presented to the host.  Hence, the selective pressure is quite intense on the molecule: It evolves quickly enough to provide sufficient variation between types for screening purposes and yet has strongly conserved areas to provide for ‘universal’ primers.  One paired set, the so-called MY09/11 consensus, has been extensively used for this purpose.  See, for other historic examples, the articles by Tenti, Nagano, Stewart and their collaborators (all 1996).
I have already prepared a multiply aligned DNA sequence dataset of the L1 region from about 50 different HPV sequences most similar to type 16 for the second scenario.  This dataset will not require the design of guessmers, as these sequences have quite a high degree of similarity, enough to make this region quite easy to align at the DNA level.  From the multiple sequence alignment provided, you will be able to design your own ‘universal’ and type/strain specific primers.  Furthermore, using the GCG primer design software, you can test the efficiency of the commercial MY09/11 universal set, and compare them to your newly designed primers.  Finally, you can review the results of a database search that I completed using the MY09/11 primers to see just how specific and/or universal they are for HPV L1 genes.


more info : please click here
Read More...

Antisense Oligonucleotide


This intriguing area started in 1970s targeting viruses, and then moved to humans to target DNA. The basic idea of this novel therapeutic approach is to synthesize a short oligonucleotide complementary to a sequence of a certain gene. Hybridization ensues, preventing expression and replication of that DNA. However several problems arose including low hybridization and non-specificity.

So with the start of the 1990s, a new approach was taken. Instead of killing the message, let's kill the messenger, mRNA.

Many successes and failures followed and the current state of the technology is that several criteria are required to assure specificity, lower side effects and optimize delivery. It appears that these agents will find many medical applications in the next few years.

What's in a name?
The message (mRNA) is the correct nucleotide sequence that encodes for a protein. It is thus said to make 'sense'. The complementary sequence is thus termed 'antisense'.

Mechanism of Action:
Blocking translation by rendering the mRNA unavailable for translation. Recent studies have shown that a more important mechanism involves a DNA-RNA hybrid that activates an enzyme, RNase H that breaks RNA strands in any RNA-DNA duplex. 

Target:
Disease states that are associated with inappropriate production or overproduction of gene products.

Advantages:
The allure of antisense oligonucleotides lies in its potential specificity, where we can target selectively the pathogenic gene. If the sequence of the gene or mRNA is known, drug design is a straight forward process. No need for laborious and tedious experiments and SARs. They are generally easy to synthesize. A small amount needs to reach the targeted cells, as mRNA is present in minute quantities.

Potential Problem:
Specificity.
Inhibiting normal cellular processes.
Susceptibility to nucleases.
Non-specific binding.
Pharmacokinetics problems; oral formulation and cellular uptake.

Specificity:
The oligonucleotide needs to be around a 17-20-mer (17-20 nucleotides) for specificity (the probability of the same sequence is one in a trillion). It has to target an area that is accessible for hybridization. The earlier oligonucleotides targeted the initiation code, but it turns out that this is not always accessible. Although some software can help eliminate certain fragments, the process usually is done by trial and error. This specificity gives these agents a tremendous advantage, this low toxicity. In some cases it would be optimal to individualize the treatment. For example if you are targeting a mutated mRNA of the c-myc in cancer patients, you may interfere with the normal cellular processes. To make these agents specific you may need to uncover the exact mutation that occurred to the c-myc and direct the antisense oligonucleotide to that particular region [remember that the exact mutation may vary from one patient to another].

Attack of Nucleases:
Problems associated with the degradation of oligonucleotides by nucleases can be reduced by a simple change to of an O to an S, resulting in phosphorothioate oligonucleotides (PS) that are stable versus nucleases. These agents are the mainstream agents to be utilized and are sometimes called first generation antisense oligonucleotides.

Non specific Binding:
The major problems associated with these oligonucleotides are due to non-specific binding, which may lead to undesired effects. One potential problem is the presence of certain sequences, such as four successive Gs that may have unwanted effects especially on the immune system. Another problem arises from secondary structures that can take place due to hybridization of the oligonucleotide with it self. This will be followed by hybridization of the remaining sequence to nonspecific targets and causing unwanted effects. The presence of polyanionic moieties leads to non specific binding to proteins and other cellular components. The effect of such binding is variable and may range from immunostimulation to induction of cell proliferation to inhibition of cell proliferation. This can be overcome by the use of Methyl Phosphonates. However the presence of anionic portions is essential to induce and activate the RNase H. So mixed backbone oligonucleotides (second generation oligonucleotides), that contains both Methyl Phosphonates and Phosphorothioates are being investigated.

Pharmacokinetics:
They cannot be used orally as of yet, but research focused on this aspect is advancing. They are used by IV infusions, are well distributed. It can be given every other day on an outpatient basis; platelet counting is necessary, with the second-generation oligonucleotides alleviating toxicity problems. Cellular entry is usually low, as they are charged molecules that appear to enter the cells through an inefficient endocytosis mechanism. Thus the use of carriers such as liposomes appears to improve their cell entry.

Uses of Oligonucleotides:
Fomivirsen (Vitravene®, ISIS 2922) is a 21-mer phosphorothioate directed against AIDS-related CMV that can induce retinitis.
Trecovirsen is a 25-mer phosphorothioate directed at the mRNA of the gag gene of HIV. The Phosphorthiote analog showed extensive toxicity and has been replaced by the second generation analog in clinical trials.
Target GFs and other proteins that may play role in cell proliferation. Clinical trials are underway for several agents:
  • ISIS 5132 that targets kinases of c-Raf, and is being tested in lung, bladder and breast cancer cells.
  • CGP64128A is a PS against PKC-α and is being tested in many cancers.
  • Oligonucleotides against Bcl-2 in lymphomas are promising especially in non-responsive lymphomas.
  • Oligonucleotides targeting Mdm-2 leads to restoration of p53 and induces apoptosis.
ISIS 2302 a 20-mer phosphorothioate directed against human intercellular adhesion molecule I (ICAM-1). It leads to inhibition of expression of this protein and shows anti-inflammatory activity in transplant rejections, Rheumatoid Arthritis and ulcerative colitis. Oligonucleotides directed against human Angiotensinogen are being tested in hypertensive patients.

New approaches:
Oligonucleotides targeting DNA. They will form a Triplex formation with DNA and inhibit replication. Oligonucleotides targeting proteins (Aptamers) have been isolated from various cells. Examples include Oligonucleotides binding to RNA Polymerase of Influenza virus, Reverse Transcriptase of HIV and those targeting thrombin (could be effective as an anticoagulant agent).
Ribozymes are RNA molecules that have a tertiary structure and can degrade RNA. They are being investigated against various disease states and viruses. They will target a specific mRNA by flanking the ribozymes with an antisense oligonucleotide specific to that mRNA.
Antisense oligonucleotides that modulate alternative gene splicing. An estimated 60% of all human genes undergo alternative splicing that produces splice variants with different functions. Such variants have been linked to a variety of cancers, and genetic diseases such as cystic fibrosis. The requirements for such oligonucleotides are different from those described, as they must not activate RNase H and effectively access the target pre-mRNAs. Methylphosphonates coupled with modifications to the bases, to increase the affinity of the oligonucleotides to their target, may facilitate favorable antisense activity in the context of splicing.
To listen to the lecture, click on one of the following links:
mp3*:   Lecture
Read More...

Genomic DNA Hyb Protocol for Oligonucleotide Array (Indirect labeling)


Shear gDNA (Hydroshear, Gene Machines) speed code 4, 30 shearing cycles, wash 3x, 2x, 5x with acid, base, TE washes as recommend by the manufacturer. (Digesting with a random four cutter is an option but may cleave in the oligo sequence for a significant percentage of the oligos. The target size is between 1-2kb. Shearing too much will result in a lower labeling efficiency as the klenow will have less room to bind on very small pieces of DNA.)

Take 2ug of DNA and bring the volume up to 23µl with ddH20.

Add DNA to 2.5X Buffer/random octamer mix (15µl random octamer at 1µg/µl + 5µl 10X NEBbuffer2 per reaction).

BOIL 5min to denature, ice. 

On ice add 5µl 10X amino-allyl dNTP mix (final concentration of reaction mix should be 3mM dA, dC, dG, and 1.2mM dT, and 1.8mM of aa-dU).

Add 1µl Klenow enz (USE Concentrated Klenow, 40-50 units per microliter available from NEB). Mix and incubate at 37˚C for 2 hours.

Stop reaction by adding 5µl .5M EDTA pH 8.0
 
Clean using Amersham Cyscribe post labeling kit:
For every 20-100µl of cDNA reaction place a GFX column in clean collection tube. Add 500µl capture buffer and then add sample. Pipette to mix. Centrifuge at max speed immediately 30s. Discard flow thru. Wash 3x with 600µl of wash Buffer. Centrifuge 1 min to dry completely. Elute in 60µl of.05M NaBicarb run through the column 2X. Dry down in speed vac and resuspend in 30µl ddH20 when ready to use.

Resuspend new tube Cy3 and Cy5 in 24µl DMSO, divide into 1. 5µl aliquots and dry down. Add sample to dry aliquot. Mix and let sit 1 hr in the dark.

Add 4.5µl Hydroxylamine to quench reaction. Mix and incubate 15min RT in the dark.

Combine Cy3 and Cy5 reactions. Repeat clean up with GFX column.

Dry down in speed vac.

Read More...

A Research on Arginine-Rich Peptides Conjugated Oligonucleotide Targeting to Telomerase

A Research on Arginine-Rich Peptides Conjugated Oligonucleotide Targeting to Telomerase

 Yuefeng Peng , Changpo Chen , Lihe Zhang 

National Research Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences and School of Chemistry & molecule engineering


Abstract:    Antisense oligonucleotide is a kind of important molecular biological research tool and potent therapeutics. However, many classes of oligonucletides are polyanions and can not pass through cell membrane. It was reported that arginine-rich peptide such HIV Tat derived peptide has transmembrane function.  Telomerase is a new target of anticancer therapy. An on-resin fragment coupling method for the peptide oligonucleotide conjugation is developed  and is applied to the assembly of arginine-rich peptide oligonucleotide conjugate. This method avoids the precipitation occurred in the solution phase fragement coupling of basic peptide and oligonucleotide. R9C,R6C and TAT conjugated ODNs targeting to telomerase are synthesized with the on-resin method. The transmembrane activity of R9C conjugated oligonucleotide was investigated using confocal fluorescence microscopy.

key words: peptide, oligonucleotide, peptide-conjugated antisense oligonucleotide, telomerase

INTRODUCTION
    With the achievement of HGP(human genome project) and the development of functional genomics, antisense drugs and antisense technology find their way in the new drug research and molecular biological science. For the therapeutic application, the problem of the permeability to the cell membrane and its instability in cells limit the biological activity of the antisense oligonucleotide. Scientists have tried to find some ways to increase oligonucleotide’s ability of penetrating cell and nucleous membrane. Recently it was demonstrated that the conjugate of transduction peptide with oligonucleotide can both increase the stability and the antisense activity of the oligonucleotide dramatically. The most attractive peptide sequence is the basic fragment of HIV Tat protein which has a arginine-rich sequence.[1] It was reported that Tat protein can penetrate both the outer membrane of cells and the membrane of nucleus. A comparative research of Tat derived peptide and polyarginine demonstrates that arginine residues play an important role in TAT protein penetrating cell membrane. [2]
Telomerase is a new target of cancer therapy. Relative studies demonstrate that over 80 percent primary cancer cells have the higher telomerase activities comparing to the normal cells. The higher activities of telomerase may relate to the maintenance of the reproductive ability of the cancer cells. Hence the inhibitors of telomerase play an important part in the research of the biological function of telomere and telomerase. Telomerase inhibitor may be developed into a new kind of anticancer agents. Telomerase consists of RNA template and enzyme protein, so the antisense oligonucleotide targeting to its RNA template can effectively inhibit the activity of telomerase in vitro. Some antisense sequences targeting to telomerase’s mRNA were suggested by Sheng-qi Wang. TRAP-PCR analysis and the result of Weston-blot showed that one of the sequences dramatically inhibits the activity of telomerase at micromole concentration.

RESULT AND DISCUSSION
1.  The peptide and oligonucletide sequences
   The antisense sequence targeting to mRNA of the telomerse protein is ACTCACTCAGGCCTCAGACT, and the antisense sequence targeting to the RNA template is CTCAGTTAGGGTTAGACAA.
    Considering the excellent transmembrane activity, we designed the argnine-rich peptide sequence and investigated the synthetic conditions for the coupling reaction between the argnine-rich peptide and ODN. The designed peptide sequences are as follows:
ArgArgArgArgArgArgCys, (R6C)
                         ArgArgArgArgArgArgArgArgArgCys, (R9C)                        
D-ArgD-ArgD-ArgD-ArgD-ArgD-ArgD-ArgD-ArgCys, (D-R9C)
ArgLysLysArgArgGlnArgArgArgCys(Tat peptide), (TAT)

2. The synthetic strategy
As mentioned above, although scientists have undergone so many meaningful exploration of the synthesis of the antisense oligonucleotide, there is not a general method for the synthesis of peptide-oligonucleotide conjugate. There are several methods for the synthesis of the argnine-rich peptide- oligonucleotide conjugates [4,7-9]. Generally, -SH group is used in the peptide sequence and linked with the ODN activated by maleimido or haloacetyl functions, or the –SH reacts with the oligonucleotide containing –SH to form the conjugate linked by -S-S-. Robles used Fmoc to protect the guanidine group of arginine and applied to synthesize the arginine-rich peptide-oligonucletide conjugate by in-line synthesis. However, when we used a double-Fmoc-protected arginine for the synthesis of the designed conjugate, we only got a complicated product. Hence, we chose to use disulfide to link the ODN and the peptide. This strategy can avoid the incompatibility of peptide chemistry and oligonucleotide chemistry in the conjugate synthesis, on the other hand, the disulfide linkage can be reduced after entering the cells and release the antisense



3. oligonucleotide synthesis
 The method for the synthesis of oligonucleotide was standard phosphoramidite chemistry and the block containing –S-S- functional group was coupled during the last step of the synthesis. After the –S-S- of ODN (I) was reduced with DTT, the mixture was purified by HPLC, and the oligonucleotide containing free –SH reacted with dithiodipyridine to form oligonucleotide (II) with the terminal sulfhlydral group. In order to investigate the penetrating activity of the designed conjugate, we also synthesized the  3’-FITC-5’-S-S-ODN (III). The 3’-amino compound (II) could react with fluorescence isothiocyanate(FITC) to produce 3’-FITC-5’-S-S-ODN (III). The resultant product was conjugated with the peptide to produce the fluorescence-labeled conjugate (IV). (Fig.2, Fig.3) 

For more information u can download here




Read More...

8th Annual Meeting of the Oligonucleotide Therapeutics Society

Join in October 28-31 in Boston, Massachusetts for the

8th Annual Meeting of the Oligonucleotide Therapeutics Society!

Join leading experts in the field during this three day meeting, which will feature the latest developments from various oligonucleotide-based disciplines including antisense, siRNA, immunomodulatory, aptamers and micro/non-coding RNA research.
Organizing Chair
Muthiah Manoharan, PhD, Alnylam Pharmaceuticals
Scientific Program Committee
Masad Damha, PhD, McGill University
Fritz Eckstein, PhD, Max Planck Institute
Anastasia Khvorova, PhD, RXi Pharma
Ryszard Kole, PhD, AVI BioPharma
Art Krieg, MD, Atlas Venture
Art Levin, PhD, Santaris Pharma A/S
Akira Matsuda, PhD, Hokkaido University
Tom Tuschl, PhD, Rockefeller University
Keynote Session
Keynote Speaker
Phillip A. Sharp, PhD, Massachusetts Institute of Technology
Plenary Speakers
John Maraganore, PhD, Alnylam Pharmaceuticals
Stanley T. Crooke, MD, PhD, Isis Pharmaceuticals
Topics will include all areas of Oligonucleotide Therapeutics covering:
• Imparting Drug-like Properties via Chemical Modifications
• Structural Biology of Therapeutic Mechanisms
• Emerging Delivery Technologies and their ADME Properties
• Novel Therapeutic Targets and Bioinformatic Tools
• Novel Mechanisms and Technologies
• Clinical Development
 
for information: click here
Read More...

FLUORESCENCE IN SITU HYBRIDIZATION USING 16S rRNA-TARGETED OLIGONUCLEOTIDE DETERMINES OF THE IDENTIFIED SYNTROPHIC SUBSTRATE OXIDIZING ANAEROBES

Fluorescence in situ hybridization (FISH) was employed to elucidate of mesophilic (35°C) and thermophilic (55°C) syntrophic substrate oxidizing anaerobes, individually. The whole microbe cell was visualized in a wet amount of each enrichment culture with substrate of benzoate, ethanol and propionate, separately. Targeted cells, which determined previously by 16S rRNA-cloning analysis as the dominant microbe, were hybridized in situ by employing the specific 16S rRNA-tergeted oligonucleotide probes. In situ hybridization with known syntrophic oligonucleotide probes reveal the clearly syntrophic cells hybridized as the dominant cell growth in culture, such as Desulfovibrio, Geobacter-like cells. For specific detection of the new identified syntrophic anaerobes-like cells, the specific oligonucleotide probes were designed. The new probes were designed for the new cluster of phylum Firmicutes, obtained from mesophilic benzoate and thermophilic ethanol culture, individually. Additionally, the probe for the new mesophilic syntrophic propionate-oxidizing anaerobe, was also designed. These study revealed the detection of the probe reacted cell as the dominant cell in culture.

from here
Read More...

Development of oligonucleotide probes and PCR primers for detecting phylogenetic subgroups of sulfate-reducing bacteria

PCR primer sets for the 16S rRNA gene of six phylogenetic groups of sulfate-reducing bacteria (SRB) were designed. Their application in conjunction with group-specific internal oligonucleotide probes was used to detect SRB DNA in samples of landfill leachate. Six generic/suprageneric groups could be differentiated: Desulfotomaculum; Desulfobulbus; Desulfobacterium; Desulfobacter; Desulfococcus–Desulfonema–Desulfosarcina; Desulfovibrio–Desulfomicrobium. The predicted specificities of the PCR primer and oligonucleotide probe combinations were confirmed with DNA from reference strains. In all cases, the PCR primers and probes were specific, the only exception being that the Desulfococcus–Desulfonema–Desulfosarcina (group 5) PCR primers were able to amplify DNA from Desulfobacterium (group 3) reference strains but these groups could nevertheless be differentiated with the internal oligonucleotide probes. The proliferation of SRB in landfill sites interferes with methanogenesis and waste stabilization, but relatively little is known about the composition of SRB populations in this environment. DNA was extracted from samples of landfill leachate from several municipal waste landfill sites and used as template in PCR reactions with SRB group-specific primer sets. Group-specific oligonucleotide probes were then used to confirm that the PCR products obtained contained the target SRB 16S rDNA. Both ‘direct’ and ‘nested’ PCR protocols were used to amplify SRB 16S rDNA from landfill leachates. Three of the six SRB groups could be detected using the ‘direct’ PCR approach (Desulfotomaculum, Desulfobacter and Desulfococcus–Desulfonema–Desulfosarcina). When ‘nested’ PCR was applied, an additional two groups could be detected (Desulfobulbus and Desulfovibrio–Desulfomicrobium). Only Desulfobacterium could not be detected in any leachate samples using either direct or nested PCR. The SRB-specific 16S rDNA primers and probes described here can be applied to investigations of SRB molecular ecology in general, and can be further developed for examining SRB population composition in relation to landfill site performance.

Keywords: sulfate-reducing bacteria, 16S rDNA, landfill, PCR primers, oligonucleotide probes 
 
for more info click here
Read More...

Using next generation sequencing to identify yellow fever virus in Uganda

In October and November 2010, hospitals in northern Uganda reported patients with suspected hemorrhagic fevers. Initial tests for Ebola viruses, Marburg virus, Rift Valley fever virus, and Crimean Congo hemorrhagic fever virus were negative. Unbiased PCR amplification of total RNA extracted directly from patient sera and next generation sequencing resulted in detection of yellow fever virus and generation of 98% of the virus genome sequence. This finding demonstrated the utility of next generation sequencing and a metagenomic approach to identify an etiological agent and direct the response to a disease outbreak.

Keywords:
Pathogen discovery
Next generation sequencing
Metagenomics
Yellow fever virus

for more download click here
Read More...

Elaboration of silica colloid/polymer hybrid support for oligonucleotide synthesis

One way to increase the sensitivity of DNA diagnostic assays developed on microarrays is to improve the solid phase that allows the extraction of the target from a biological sample, before detection. Two parameters are influencing the performances of this capture step: (i) the specific surface area being offered for the capture and (ii) the number and the accessibility of oligonucleotide probes immobilized on the surface. In this context, we have developed an attractive approach which fulfills these two points. Our strategy was to elaborate a new material of high specific surface area, suitable to serve as support for both solid-phase oligonucleotide synthesis and in vitro diagnostic assay. This material has consisted of aggregates of colloidal amino-silica nanoparticles covalently linked by poly(ethylene oxide) (PEO) arms. The aggregation of amino-silica particles in the presence of reactive bis-isocyanate PEO was achieved in a controlled manner. The aggregate size and structure were examined by microscopy. The specific surface area of this material was measured by nitrogen adsorption technique. The composition of aggregate was studied by thermogravimetry and X-ray photoelectron spectroscopy. Then, this material has been successfully used as support for oligonucleotide synthesis of high yield and purity.

Keywords: Silica particle; Poly(ethylene oxide); Aggregate; Oligonucleotide synthesis; Solid-phase synthesis

For more download, click here
Read More...

Universal ribotyping method using a chemically labelled oligonucleotide probe mixture

Some of the present problems in ribotyping are associated with a lack of uniform reactivity of probes when bacterial DNAs are of phylogenetically diverse origins. To overcome these problems, a set of five oligonucleotides (referred to as OligoMix5) was selected to react with conserved sequences located near both extremities of rrs (16s rRNA gene) and near both extremities and the middle of rr/ 123s rRNA gene). DNA samples from 13 bacterial species selected to represent various phylogenetic branches within the Eubacteria were cleaved by a restriction endonuclease and electrophoresed in 0.8% agarose, and the fragments were vacuum-transferred to nylon membranes and hybridized with digoxigenin-labelled OligoMix5, plasmid DNA from pKK3535 (cloned rm operon from Escherichia co/r) or pBA2 (cloned rrs from Bacillus subfilis), or acetylaminofluorene- labelled E. co/i 16+23S rRNA. The results showed OligoMix5 to visualize patterns in DNA from phylogenetically diverse bacteria with comparable intensity. Banding patterns (not band intensity) obtained with OligoMix5 were identical with those obtained with 16+23S rRNA or plasmid pKK3535 for each strain studied and represented complete ribotypes. For DNA from Gram-positive bacteria, complete ribotypes were observed after prolonged enzymatic detection of bands when probes were either E. co/i 16+23S rRNA or pKK3535. Patterns given by plasmid pBA2 were subsets of the complete ribotypes for 9113 strains. Each oligonucleotide of the OligoMix5 set was used as a probe to determine its contribution to the complete ribotype. The five oligonucleotide probes, used individually, visualized one to four patterns per DNA sample. Use of DNA from Xenorhabdus sp. CIP 105189 cleaved by EcoRl is suggested to control the quality of the oligonucleotide probes composing OligoMix5. Probe OligoMix5 was found to be an essential tool for ribotyping phylogenetically diverse eubacteria.

For more download, click here
Read More...